Sequence ID | >WENV170014408 |
Genome ID | AYRF01034651 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 118 |
End posion on genome | 191 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tgtagtgata |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCAGAAGCTTCCCAAGCTTAAGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
gacctgcttt |
Secondary structure (Cloverleaf model) | >WENV170014408 Gly CCC a TCCA gacctgcttt G - C C - G G - C G - C G + T T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A A AGAC G A A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |