Sequence ID | >WENV170014411 |
Genome ID | AYRF01040174 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 208 |
End posion on genome | 119 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ngcacaagcg |
tRNA gene sequence |
GGAGAGTTGCCGGAGTGGTCGAACGGGGCGGTCTCGAAAACCGTTGAGCCTTTACGGGTT |
Downstream region at tRNA end position |
ctatcccctt |
Secondary structure (Cloverleaf model) | >WENV170014411 Ser CGA g GCCA ctatcccctt G - C G - C A - T G - C A - T G - C T T T A T G T C C C A T G A G | | | | | G G G G C C C A G G G C G | | | T T T A C G G C G A G TGAGCCTTTACGGGTTCC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |