Sequence ID | >WENV170014412 |
Genome ID | AYRF01040246 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 121 |
End posion on genome | 195 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cccacacagt |
tRNA gene sequence |
TGGGGTGTGGCCAAGTGGTAAGGCAACAGTTTTTGGTACTGAAGATCGTAGGTTCGAATC |
Downstream region at tRNA end position |
gttttctcag |
Secondary structure (Cloverleaf model) | >WENV170014412 Gln TTG t GCCA gttttctcag T - A G - C G - C G - C G - C T - A G - C T A T C A T C C A G A G | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A AGATC A A C - G A - T G - C T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |