Sequence ID | >WENV170014414 |
Genome ID | AYRF01041983 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 166 |
End posion on genome | 91 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
agctcaacac |
tRNA gene sequence |
GCCCGGATAGCTCAGTTGGTAGAGCAGGGGATTGAAAATCCCCGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
ttagaattca |
Secondary structure (Cloverleaf model) | >WENV170014414 Phe GAA c ACCA ttagaattca G - C C - G C - G C - G G - C G - C A - T T T T C C G C C A T G A A | | + | | G T C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C G - C G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |