Sequence ID | >WENV170014416 |
Genome ID | AYRF01042368 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 206 |
End posion on genome | 131 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
nnnnnccact |
tRNA gene sequence |
ACGGGCGTAGCTCAGTTGGTAGAGTACTGGTCTCCAAAACCATTGGTCGTGGGTTCGAAT |
Downstream region at tRNA end position |
aattgaaaga |
Secondary structure (Cloverleaf model) | >WENV170014416 Trp CCA t GCAA aattgaaaga A - T C - G G - C G - C G - C C - G G - C T A T C A T C C A T G A A | | + | | G T C T C G G T G G G C G | | | + T T G G A G T T A A TGGTC C T T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |