Sequence ID | >WENV170014417 |
Genome ID | AYRF01044187 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 184 |
End posion on genome | 108 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gccccgttga |
tRNA gene sequence |
CGGCATGTAGCGCAGCTTGGTAGCGCACTTCGTTCGGGACGAAGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
ttttccctcc |
Secondary structure (Cloverleaf model) | >WENV170014417 Pro CGG a ACCA ttttccctcc C - G G - C G - C C - G A C T - A G - C T A T T C T C C A C G A A + | | | | G T C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |