Sequence ID | >WENV170014418 |
Genome ID | AYRF01046655 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 143 |
End posion on genome | 70 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ggacatctgg |
tRNA gene sequence |
GCGGGTATGGTGAAATGGTATCATAAGAGCCTTCCAAGCTTAAGGTGCGGGTTCGATTCC |
Downstream region at tRNA end position |
tttctccaaa |
Secondary structure (Cloverleaf model) | >WENV170014418 Gly TCC g TCCA tttctccaaa G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A A A G | | | | | G T A G T G G C G G G C G | | | + T T G T C A T T A A AGGT A A G + T A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |