| Sequence ID | >WENV170014425 |
| Genome ID | AYRG01000026 |
| Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
| Species | |
| Start position on genome | 36265 |
| End posion on genome | 36340 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
ttcaaattac |
| tRNA gene sequence |
GACCCTGTCGTCTAGTGGCCAAGGACATTTGGATTTCCTCCAAAGAACGCAAGTTCGAAT |
| Downstream region at tRNA end position |
tttttttatt |
| Secondary structure (Cloverleaf model) | >WENV170014425 Glu TTC
c GCCA tttttttatt
G - C
A - T
C - G
C - G
C - G
T + G
G + T T A
T C G T T C A
T G A C | | | | | G
G T C T G G C A A G C
G + | | | T T
C G G A C
C A A A GAAC
T - A
T - A
T - A
G - C
G - C
A T
T C
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |