Sequence ID | >WENV170014427 |
Genome ID | AYRG01000041 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 20273 |
End posion on genome | 20201 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tattaaagat |
tRNA gene sequence |
GCTCCCATGGCTCAGTCGGTAGAGCGATTCACTCGTAATGAATAGGTCAGCGGTTCGATT |
Downstream region at tRNA end position |
ttgtttatac |
Secondary structure (Cloverleaf model) | >WENV170014427 Thr CGT t Tttt ttgtttatac G - C C - G T - A C - G C - G C - G A - T T T T T C G C C A T G A G | | | | | G C C T C G A G C G G C G | | | | T T G G A G C T A G AGGTC A - T T - A T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |