Sequence ID | >WENV170014440 |
Genome ID | AYRG01000115 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1783 |
End posion on genome | 1858 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aactacaaat |
tRNA gene sequence |
AGGTCAGTAGCTCCAATGGTAGAGCGCCGGATTCCAAATCCGATGGTTGTGGGTTCGAGT |
Downstream region at tRNA end position |
cttattcttt |
Secondary structure (Cloverleaf model) | >WENV170014440 Trp CCA t GCCA cttattcttt A - T G - C G - C T + G C - G A - T G - C T G T C T C C C A A A C A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G TGGTT C A C - G G - C G - C A - T T A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |