Sequence ID | >WENV170014447 |
Genome ID | AYRG01000173 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 605 |
End posion on genome | 680 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
caatctcaat |
tRNA gene sequence |
GACCCTGTCGTCTAGTGGCCAAGGACCTCAGGATTTCCTCCTGATGACGCAAGTTCAAAT |
Downstream region at tRNA end position |
accattttat |
Secondary structure (Cloverleaf model) | >WENV170014447 Glu TTC t GCCA accattttat G - C A - T C - G C - G C - G T + G G + T T A T C G T T C A T G A C | | | | | A G T C T G G C A A G C G + | | | T T C G G A C C A A C TGAC T - A C - G A - T G - C G - C A T T C T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |