Sequence ID | >WENV170014452 |
Genome ID | AYRG01000372 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 4152 |
End posion on genome | 4077 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gtaacatctt |
tRNA gene sequence |
GCCGCCTTAGCTCACTAGGTAGAGCAGTACCATGGTAAGGTAGAGGTAGCCGGTTCGACT |
Downstream region at tRNA end position |
ctataataaa |
Secondary structure (Cloverleaf model) | >WENV170014452 Thr GGT t ACCA ctataataaa G - C C - G C - G G + T C - G C - G T - A T C T C G G C C A T C A A | | | | | G A C T C G G C C G G C G | | | | T T G G A G C T A A AGGTA G G T - A A - T C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |