Sequence ID | >WENV170014471 |
Genome ID | AYRG01001181 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 2211 |
End posion on genome | 2136 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aatttaataT |
tRNA gene sequence |
GGCGAAGTAGCTCAGATGGCTAGAGCATACGGTTCATACCCGTAGTGTCGGCGGTTCGAT |
Downstream region at tRNA end position |
aaacaccaaa |
Secondary structure (Cloverleaf model) | >WENV170014471 Met CAT T ATta aaacaccaaa G + T G - C C - G G - C A - T A - T G - C T T T C T G C C A A G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C C T A A GTGTC T - A A - T C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |