Sequence ID | >WENV170014474 |
Genome ID | AYRG01001314 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1943 |
End posion on genome | 2024 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttgtcgctac |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGGGCAGACTGTAAATCTGTTGTCTACGACTTCGAA |
Downstream region at tRNA end position |
annnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170014474 Tyr GTA c Atta annnnnnnnn G - C G - C A - T G - C G - C G - C G + T T A T C T T C C A T G A T | | | | | G G G C C C G A A G G C G | | | T T C A G G G C A A G TGTCTACGACTTC G + T C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |