Sequence ID | >WENV170014481 |
Genome ID | AYRG01002036 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 921 |
End posion on genome | 832 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
agcgaattgc |
tRNA gene sequence |
GGTGAAGTGTCCGAGTGGCTGAAGGAGCTCGCCTGGAAAGCGTGTATAGGAGAAATCTTA |
Downstream region at tRNA end position |
tacagcctac |
Secondary structure (Cloverleaf model) | >WENV170014481 Ser GGA c GCCA tacagcctac G - C G - C T - A G - C A - T A - T G - C T A T C T C C C A T G A G | | | | | G G G C C T G A G G G C G | | | T T C A G G A T G A G TATAGGAGAAATCTTATC C - G T T C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |