Sequence ID | >WENV170014487 |
Genome ID | AYRG01002558 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 821 |
End posion on genome | 746 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
acgcaatatg |
tRNA gene sequence |
GTGGGCGTAGCTCAGTTGGTAGAGCACGGGATTGTGATTCCCGGTGTCGTGGGTTCGAGA |
Downstream region at tRNA end position |
tattttgaaa |
Secondary structure (Cloverleaf model) | >WENV170014487 His GTG g CCCA tattttgaaa G - C T - A G - C G - C G + T C - G G - C A G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A GTGTC C - G G - C G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |