Sequence ID | >WENV170014488 |
Genome ID | AYRG01002558 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 696 |
End posion on genome | 612 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tgagtaacat |
tRNA gene sequence |
GCGGACGTGGTGGAATTGGTAGACACACCAGATTTAGGTTCTGGCGCCGCGAGGTGTGAG |
Downstream region at tRNA end position |
tctagaggct |
Secondary structure (Cloverleaf model) | >WENV170014488 Leu TAG t ACCA tctagaggct G - C C - G G - C G - C A - T C - G G + T T G T C T C T C A T A A G | | | | | G T G G T G G A G A G C G | | | T T G A C A C T A G A CGCCGCGAGGTGT C - G C - G A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |