Sequence ID | >WENV170014495 |
Genome ID | AYRG01003258 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 193 |
End posion on genome | 268 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
cgttaaaaat |
tRNA gene sequence |
GGGGCCATAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCGGTTCGATC |
Downstream region at tRNA end position |
ttatccaatc |
Secondary structure (Cloverleaf model) | >WENV170014495 Ala TGC t ACCA ttatccaatc G - C G - C G + T G - C C - G C - G A - T C T T T C G C C A C G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G C C T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |