Sequence ID | >WENV170014500 |
Genome ID | AYRG01004308 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 317 |
End posion on genome | 242 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ataaaagtaT |
tRNA gene sequence |
GTGCCTGTAGCTCAGTCGGATAGAGCACTGGCCTTCTAAGCCAGGTGTCATGGGTTCGAA |
Downstream region at tRNA end position |
gtttcaaata |
Secondary structure (Cloverleaf model) | >WENV170014500 Arg TCT T GTtt gtttcaaata G - C T - A G - C C - G C - G T - A G - C T A T T C C C C A T G A A | | | | G C C T C G A T G G G C G | | | | T T G G A G C A T A A GTGTC C - G T - A G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |