Sequence ID | >WENV170014509 |
Genome ID | AYRG01005331 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 255 |
End posion on genome | 183 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
nnnnnnatat |
tRNA gene sequence |
GCCGACGTGGCTCAATTGGCAGAGCAGCTGACTTGTAATCAGCAGGTTATCGGTTCGAGT |
Downstream region at tRNA end position |
tataaaatta |
Secondary structure (Cloverleaf model) | >WENV170014509 Thr TGT t Ttta tataaaatta G - C C - G C - G G - C A - T C - G G - C T G T T A G C C A T A A G | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |