Sequence ID | >WENV170014510 |
Genome ID | AYRG01005331 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 154 |
End posion on genome | 81 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aagtagatgg |
tRNA gene sequence |
GGGCCATTAGCTCAGTTGGTCAGAGCATCCGGCTCATAACCGGAGAGTCCGGGGTTCGAG |
Downstream region at tRNA end position |
atattttata |
Secondary structure (Cloverleaf model) | >WENV170014510 Met CAT g Attt atattttata G - C G - C G - C C - G C - G A - T T - A T G T G T C C C A T G A A | + | | | G T C T C G C G G G G C G | | | | T T G G A G C T C A A GAGTC T - A C - G C - G G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |