Sequence ID | >WENV170014512 |
Genome ID | AYRG01005516 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 137 |
End posion on genome | 65 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tgtagaatga |
tRNA gene sequence |
AGGGGTATAGTTCAGTTGGTAGAACGTCGGTCTCCAAAACCGGATGTCGTGGGTTCAAGT |
Downstream region at tRNA end position |
gtggcccagt |
Secondary structure (Cloverleaf model) | >WENV170014512 Trp CCA a Gtta gtggcccagt A - T G - C G - C G - C G - C T + G A - T T G T C A T C C A T G A A | | + | | A T C T T G G T G G G C G | | | | T T G G A A C T A G ATGTC T + G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |