Sequence ID | >WENV170014513 |
Genome ID | AYRG01005558 |
Phylum/Class | [AYRG] bioreactor metagenome; day 33 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 94 |
End posion on genome | 164 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aaaaacatat |
tRNA gene sequence |
GGCGCCATAGCCAAGTGGTAAGGCAGAGGTCTGCAACACCTTCATCACCAGTTCAAATCT |
Downstream region at tRNA end position |
caactaacgc |
Secondary structure (Cloverleaf model) | >WENV170014513 Cys GCA t Ttaa caactaacgc G - C G - C C - G G - C C - G C - G A - T T A T T G G T C A G A A | | | | | A T A C C G A C C A G C G | | | T T G A G G C T A A CATC G + T A - T G - C G - C T - A C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |