Sequence ID | >WENV170014514 |
Genome ID | AYRH01000024 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 3612 |
End posion on genome | 3696 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
accaaccgtt |
tRNA gene sequence |
GCCCCCGTGGCGGAACTGGTAGACGCGTCGGATTCAAAATCCGATTTCTTCGGAAGTGCC |
Downstream region at tRNA end position |
ctcttctttc |
Secondary structure (Cloverleaf model) | >WENV170014514 Leu CAA t ACCA ctcttctttc G - C C - G C - G C - G C - G C - G G - C T G T C G G T C A C A A G | | | | | G T G G C G G C C A G C G | | | T T G A C G C T A G G TTTCTTCGGAAGT T - A C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |