Sequence ID | >WENV170014516 |
Genome ID | AYRH01000214 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1600 |
End posion on genome | 1514 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gatgatatgt |
tRNA gene sequence |
GCCCAGATGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGCTAGTGCCCGCAAGGGCGTG |
Downstream region at tRNA end position |
tcattttttc |
Secondary structure (Cloverleaf model) | >WENV170014516 Leu CAG t ACCA tcattttttc G - C C - G C - G C - G A - T G - C A - T T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G G TGCCCGCAAGGGCGT C - G T - A A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |