Sequence ID | >WENV170014518 |
Genome ID | AYRH01000282 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 23 |
End posion on genome | 98 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aacgcgacag |
tRNA gene sequence |
GCCCGGATAGCTCAGTTGGTAGAGCAGCGGATTGAAAATCCGCGTGTCGGTGGTTCGAAT |
Downstream region at tRNA end position |
ctctttttcc |
Secondary structure (Cloverleaf model) | >WENV170014518 Phe GAA g ACCA ctctttttcc G - C C - G C - G C - G G - C G - C A - T T A T C C G C C A T G A A | | + | | G T C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC G - C C - G G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |