Sequence ID | >WENV170014519 |
Genome ID | AYRH01000331 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1182 |
End posion on genome | 1106 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcctcactgt |
tRNA gene sequence |
CGCGGGATGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
attttcagct |
Secondary structure (Cloverleaf model) | >WENV170014519 Met CAT t ACCA attttcagct C A G - C C - G G - C G - C G - C A - T T A T C A T C C A C G A G | | | | | A C C G A G G T A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |