Sequence ID | >WENV170014520 |
Genome ID | AYRH01000339 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1566 |
End posion on genome | 1490 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
acaaaaaaat |
tRNA gene sequence |
GGTCCCGTAGCTCAGCTGGATAGAGTGTTCGCCTCCGAAGCGAAAGGTCGCGCGTTCGAA |
Downstream region at tRNA end position |
ttcctcaaaa |
Secondary structure (Cloverleaf model) | >WENV170014520 Arg CCG t ACCA ttcctcaaaa G - C G - C T - A C - G C - G C - G G - C T A T C G C G C A C G A A | | | | | G T C T C G G C G C G C G | | | + T T G G A G T A T A G AGGTC T - A T - A C - G G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |