Sequence ID | >WENV170014522 |
Genome ID | AYRH01000378 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1313 |
End posion on genome | 1238 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cgaagacgac |
tRNA gene sequence |
GCCGGTATAGCTCAGATGGTAGAGCACCTGACTTGTAATCAGGGGGTCGCGGGTTCGATC |
Downstream region at tRNA end position |
ctcttcttct |
Secondary structure (Cloverleaf model) | >WENV170014522 Thr TGT c ACCA ctcttcttct G - C C - G C - G G - C G - C T + G A - T C T T C G T C C A A G A A | | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |