Sequence ID | >WENV170014528 |
Genome ID | AYRH01001015 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1064 |
End posion on genome | 1139 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
agcgcgcagt |
tRNA gene sequence |
AGGGGTATAGCTCAGTTGGTAGAGCGACGGTCTCCAAAACCGTAGGCCCACAGTTCGAGT |
Downstream region at tRNA end position |
ttatcaccaa |
Secondary structure (Cloverleaf model) | >WENV170014528 Trp CCA t GCCA ttatcaccaa A - T G - C G - C G - C G - C T + G A - T T G T G T G T C A T G A A | | | | | G T C T C G C A C A G C G | | | | T T G G A G C T A G AGGCC A - T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |