Sequence ID | >WENV170014532 |
Genome ID | AYRH01001199 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 352 |
End posion on genome | 426 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cacacagcaa |
tRNA gene sequence |
TGGGGTGTAGCCAAGTGGTAAGGCAACGGTTTTTGGTATCGTGTACCGTAGGTTCGAATC |
Downstream region at tRNA end position |
atttttcctg |
Secondary structure (Cloverleaf model) | >WENV170014532 Gln TTG a GCCA atttttcctg T - A G - C G - C G - C G - C T - A G - C T A T C A T C C A G A A | | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GTACC A - T C - G G - C G + T T - A T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |