Sequence ID | >WENV170014533 |
Genome ID | AYRH01001324 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 316 |
End posion on genome | 240 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ccctcaccgc |
tRNA gene sequence |
GCTCTGGTAGCTCAGCTGGATAGAGTACTTGACTACGAATCAAGGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ttacaaacaa |
Secondary structure (Cloverleaf model) | >WENV170014533 Arg ACG c GCCA ttacaaacaa G - C C - G T - A C - G T - A G - C G - C T A T C C T C C A C G A A | | + | | G T C T C G G G G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |