Sequence ID | >WENV170014534 |
Genome ID | AYRH01001568 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 598 |
End posion on genome | 522 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttgccccagc |
tRNA gene sequence |
GGTCCCTTAGCTCAACCGGATAGAGCATCTGCCTTCTAAGCAGAGGGTTGCAGGTTCGAG |
Downstream region at tRNA end position |
attgttcatt |
Secondary structure (Cloverleaf model) | >WENV170014534 Arg TCT c GCCA attgttcatt G - C G + T T - A C - G C - G C - G T - A T G T C G T C C A C A A A | | | | | G C C T C G G C A G G C G | | | | T T G G A G C A T A A GGGTT T - A C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |