Sequence ID | >WENV170014536 |
Genome ID | AYRH01001811 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 418 |
End posion on genome | 345 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
caccacacgg |
tRNA gene sequence |
GGCCTCTTGGCGGAGTGGTGACGCAGCGGATTGCAAATCCGTGTACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
cttttcttct |
Secondary structure (Cloverleaf model) | >WENV170014536 Cys GCA g TCCA cttttcttct G - C G - C C - G C - G T - A C - G T - A T T T C G G C C A G A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T G A GTAC G + T C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |