Sequence ID | >WENV170014538 |
Genome ID | AYRH01001938 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 503 |
End posion on genome | 414 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccacacagcc |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTTGAATGCACTGGTCTTGAAAACCAGCGGGCGTGGAAGCGTC |
Downstream region at tRNA end position |
tctatcttat |
Secondary structure (Cloverleaf model) | >WENV170014538 Ser TGA c GCCA tctatcttat G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | | | T T T A T G C T G A A CGGGCGTGGAAGCGTCTC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |