Sequence ID | >WENV170014539 |
Genome ID | AYRH01001944 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 60 |
End posion on genome | 136 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tttggattga |
tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTTAGAGTGCCGGCCTGTCACGCCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
ctttcattta |
Secondary structure (Cloverleaf model) | >WENV170014539 Asp GTC a GCCA ctttcattta G - C C - G G - C G + T G - C T - A G - C T G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |