Sequence ID | >WENV170014540 |
Genome ID | AYRH01001986 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 497 |
End posion on genome | 580 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ccctccccat |
tRNA gene sequence |
GGTGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGCGCGAGCTTCGGTG |
Downstream region at tRNA end position |
tctttatgtt |
Secondary structure (Cloverleaf model) | >WENV170014540 Tyr GTA t ACCA tctttatgtt G - C G - C T - A G - C G - C G - C G - C T A T C C A C C A T G A T | | | | | G G G C C C G G T G G C G | | | T T C A G G G C A A A CGCGCGAGCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |