Sequence ID | >WENV170014543 |
Genome ID | AYRH01002941 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 763 |
End posion on genome | 674 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GGAGAGTTGCCGGAGTGGTCGAACGGGGCGGTCTCGAAAACCGTTGAGCGCGCAAGCGTT |
Downstream region at tRNA end position |
tttttattca |
Secondary structure (Cloverleaf model) | >WENV170014543 Ser CGA n GCCA tttttattca G - C G - C A - T G - C A - T G - C T - A T A T C T C C C A T G A G | | | | | G G G G C C G A G G G C G | | | T T T A C G G C G A G TGAGCGCGCAAGCGTTCC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |