Sequence ID | >WENV170014545 |
Genome ID | AYRH01003751 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 472 |
End posion on genome | 546 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gagatttcta |
tRNA gene sequence |
GGGCGATTAGCTCAGCGGTAGAGCACTTCGTTGACATCGAAGGGGTCACTGGTTCGATCC |
Downstream region at tRNA end position |
tgaaccgtct |
Secondary structure (Cloverleaf model) | >WENV170014545 Val GAC a ACCA tgaaccgtct G - C G - C G - C C - G G - C A - T T - A C T T T G A C C A G A A | | | | | G C C T C G A C T G G C G | | | | T T G G A G C T A A GGGTC C - G T - A T - A C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |