Sequence ID | >WENV170014548 |
Genome ID | AYRH01005030 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 7 |
End posion on genome | 83 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
nnnncaaaac |
tRNA gene sequence |
GGTCCCTTAGCTCAGCTGGATAGAGCACCGGCCTTCTAAGCCGACGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ctcttttcca |
Secondary structure (Cloverleaf model) | >WENV170014548 Arg TCT c GCCA ctcttttcca G - C G + T T - A C - G C - G C - G T - A T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A CGGTC C A C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |