Sequence ID | >WENV170014549 |
Genome ID | AYRH01005133 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 584 |
End posion on genome | 508 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tctctccagt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCGACGGTTTTGGGTACCGTAGGTCGCAAGTTCGAA |
Downstream region at tRNA end position |
tcttccactt |
Secondary structure (Cloverleaf model) | >WENV170014549 Pro TGG t ACCA tcttccactt C - G G - C G - C G - C G + T C - G G - C T A T C G T T C A C G A A | | | | | G C C G C G G C A A G C T | | | | T T G G C G C G T A G AGGTC A - T C - G G - C G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |