Sequence ID | >WENV170014551 |
Genome ID | AYRH01006094 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 130 |
End posion on genome | 55 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gttgagaagt |
tRNA gene sequence |
TCCTCGATAGCTCAGTTGGTAGAGCAGTAGACTGTTAATCTATTGGTCGCTGGTTCGAGT |
Downstream region at tRNA end position |
aaaagggtcg |
Secondary structure (Cloverleaf model) | >WENV170014551 Asn GTT t GCCA aaaagggtcg T - A C - G C - G T - A C - G G - C A - T T G T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A A TGGTC G + T T - A A - T G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |