Sequence ID | >WENV170014554 |
Genome ID | AYRH01006798 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 245 |
End posion on genome | 321 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gacccacttc |
tRNA gene sequence |
AGGACTATAGCTCAGTTGGTTAGAGCGCTACCTTGACATGGTAGAGGTCGGCGGTTCGAA |
Downstream region at tRNA end position |
gattctgaat |
Secondary structure (Cloverleaf model) | >WENV170014554 Val GAC c ACCA gattctgaat A - T G - C G - C A - T C - G T - A A - T T A T C C G C C A T G A A | | | | | G T C T C G G G C G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |