Sequence ID | >WENV170014556 |
Genome ID | AYRH01007522 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 122 |
End posion on genome | 46 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gatatgagat |
tRNA gene sequence |
GGCGTGGTAGCTCAGCTGGTTAGAGCACAGCACTCATAATGCTGGGGTCGGTGGTTCAAG |
Downstream region at tRNA end position |
tatctgacca |
Secondary structure (Cloverleaf model) | >WENV170014556 Met CAT t ACCA tatctgacca G + T G - C C - G G - C T - A G - C G + T T G T C C A C C A C G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T G - C C - G A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |