Sequence ID | >WENV170014559 |
Genome ID | AYRH01008169 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 440 |
End posion on genome | 364 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgcaccggat |
tRNA gene sequence |
GGCGGGGTAGCTCAGTTGGTTAGAGCAGCGGAATCATAATCCGCGTGTCGGGGGTTCAAG |
Downstream region at tRNA end position |
tctctcttca |
Secondary structure (Cloverleaf model) | >WENV170014559 Met CAT t ACCA tctctcttca G + T G - C C - G G - C G + T G - C G - C T G T C T C C C A T G A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C T T A A GTGTC G - C C - G G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |