Sequence ID | >WENV170014565 |
Genome ID | AYRH01010645 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 199 |
End posion on genome | 123 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cccgaaacag |
tRNA gene sequence |
GCACCCGTAGCTCAGTTGGATAGAGCGCTGCCCTCCGAAGGCAGAGGCCATAGGTTCGAA |
Downstream region at tRNA end position |
tacttttcaa |
Secondary structure (Cloverleaf model) | >WENV170014565 Arg CCG g ACCA tacttttcaa G - C C - G A - T C - G C - G C - G G - C T A T T A T C C A T G A A | | | | | G T C T C G A T A G G C G | | | | T T G G A G C A T A G AGGCC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |