Sequence ID | >WENV170014570 |
Genome ID | AYRH01013105 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 231 |
End posion on genome | 155 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tgttttttac |
tRNA gene sequence |
AGTCCCATAGCTCAGTTGGTTAGAGCGCTACACTGATAATGTAGAGGTCCGCAGTTCAAA |
Downstream region at tRNA end position |
aagaaaaaga |
Secondary structure (Cloverleaf model) | >WENV170014570 Ile GAT c ACAA aagaaaaaga A - T G - C T - A C - G C - G C - G A - T T A T G C G T C A T G A A | | | | | A T C T C G C G C A G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |