Sequence ID | >WENV170014572 |
Genome ID | AYRH01014425 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 142 |
End posion on genome | 66 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
caaaaacagt |
tRNA gene sequence |
CGGTGAATAGCGCAGCTTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
ctatttcaat |
Secondary structure (Cloverleaf model) | >WENV170014572 Pro TGG t ACCA ctatttcaat C - G G - C G - C T - A G - C A - T A - T T A T C T C C C A C G A A | + | | | G T C G C G G G G G G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |