Sequence ID | >WENV170014575 |
Genome ID | AYRH01015260 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 228 |
End posion on genome | 312 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tttttagaat |
tRNA gene sequence |
GCGGATATGGTGAAATTGGTAGACATGCTAGACTTAGGATCTAGTGCCGCGAGGCGTGTG |
Downstream region at tRNA end position |
aattaaaagt |
Secondary structure (Cloverleaf model) | >WENV170014575 Leu TAG t ACAA aattaaaagt G - C C - G G - C G - C A - T T - A A - T T G T C T C C C A T A A G | | | | G T A G T G G T G G G C G | | + T T G A C A T T A G G TGCCGCGAGGCGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |