Sequence ID | >WENV170014577 |
Genome ID | AYRH01016871 |
Phylum/Class | [AYRH] bioreactor metagenome; day 46 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 287 |
End posion on genome | 213 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gaaacagaat |
tRNA gene sequence |
GCGGGCGTAGCTCAGGGGTAGAGCATAACCTTGCCAAGGTTAGGGTCGTGAGTTCGAATC |
Downstream region at tRNA end position |
gtttctttaa |
Secondary structure (Cloverleaf model) | >WENV170014577 Gly GCC t TCCA gtttctttaa G - C C - G G - C G - C G - C C - G G - C T A T T A C T C A G A A + | | | | G G C T C G G T G A G C G | | | | T T G G A G C T A A GGGTC T - A A - T A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |